WormBase Tree Display for Variation: WBVar02123871
expand all nodes | collapse all nodes | view schema
WBVar02123871 | Name | Public_name | WBVar02123871 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854794 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_I | ||||
Flanking_sequences | TGGAATCCCCAATTCCGGAGTTCTATCCGA | ATGATGACATTCTGGATATAAAGCTCTAAG | ||||||
Mapping_target | CHROMOSOME_I | |||||||
Source_location | 225 | CHROMOSOME_I | 12457001 | 12476000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022902 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001640 | ||||||
WBGene00014714 | ||||||||
WBGene00044242 | ||||||||
WBGene00012102 | ||||||||
WBGene00008294 | ||||||||
WBGene00077508 | ||||||||
WBGene00008295 | ||||||||
Transcript | C54C8.7.1 | |||||||
T27F6.10.1 | ||||||||
C54C8.11b.1 | ||||||||
C54C8.9.1 | ||||||||
T27F6.1.1 | ||||||||
C54C8.11a.1 | ||||||||
C54C8.12.1 | ||||||||
Pseudogene | C54C8.8 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |