WormBase Tree Display for Variation: WBVar02123801
expand all nodes | collapse all nodes | view schema
WBVar02123801 | Name | Public_name | WBVar02123801 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854724 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | GATAAGGCCAGAATTGGCTCCAATCGGACA | AAAAAAAAAACTCAAAATGACACAGTTTTA | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 759001 | 777000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022899 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00018933 | ||||||
WBGene00000677 | ||||||||
WBGene00305455 | ||||||||
WBGene00001788 | ||||||||
WBGene00018928 | ||||||||
WBGene00021947 | ||||||||
WBGene00018932 | ||||||||
WBGene00018929 | ||||||||
Transcript | F56B3.16 | |||||||
F56B3.10.1 | ||||||||
F56B3.9.1 | ||||||||
F56B3.8b.1 | ||||||||
Y55F3C.2.1 | ||||||||
F56B3.2.1 | ||||||||
F56B3.8a.1 | ||||||||
F56B3.1.1 | ||||||||
Pseudogene | F56B3.3 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |