WormBase Tree Display for Variation: WBVar02123686
expand all nodes | collapse all nodes | view schema
WBVar02123686 | Name (2) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | Y105C5B | ||||
Flanking_sequences | GTAATTTTAACTAATAAATGCACATTCCGA | CAAATAATCAATCGCTTCACAATGCCTAAA | ||||||
Mapping_target | Y105C5B | |||||||
Source_location | 225 | CHROMOSOME_IV | 15936001 | 15954000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022886 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene (54) | |||||||
Transcript (55) | ||||||||
Pseudogene | Y105C5B.12 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |