WormBase Tree Display for Variation: WBVar02123248
expand all nodes | collapse all nodes | view schema
WBVar02123248 | Name | Public_name | WBVar02123248 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854171 | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK896 | ||||
Flanking_sequences | ACATTTTAATTCGAAAAAAACACGGGGTTC | GGTTTCGTGCATTCACGTTGTACTGCGGTC | ||||||
Mapping_target | ZK896 | |||||||
Source_location | 225 | CHROMOSOME_IV | 12856001 | 12870000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00023072 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001543 | ||||||
WBGene00014139 | ||||||||
WBGene00014137 | ||||||||
WBGene00014138 | ||||||||
WBGene00173710 | ||||||||
Transcript | ZK896.12 | |||||||
ZK896.9b.1 | ||||||||
ZK896.9a.1 | ||||||||
ZK896.7.1 | ||||||||
ZK896.8.1 | ||||||||
ZK896.6.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |