WormBase Tree Display for Variation: WBVar02122658
expand all nodes | collapse all nodes | view schema
WBVar02122658 | Name | Public_name | WBVar02122658 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853581 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | TGCACTAGTCTCTGGCACTTGAACATCTTTGTGCTCGACAATTTCAGCTG | CCGAAGGTGCTGCTACCGTTGGAACTTCTT | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 6179001 | 6189000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023139 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00027648 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006436 | ||||||
Transcript | W06H8.8f.1 | |||||||
W06H8.8b.1 | ||||||||
W06H8.8a.1 | ||||||||
W06H8.8i.1 | ||||||||
W06H8.8a.2 | ||||||||
W06H8.8h.1 | ||||||||
W06H8.8d.1 | ||||||||
W06H8.8g.1 | ||||||||
W06H8.8e.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |