WormBase Tree Display for Variation: WBVar02122081
expand all nodes | collapse all nodes | view schema
WBVar02122081 | Name | Public_name | WBVar02122081 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853004 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_II | ||||
Flanking_sequences | GTCACTCCCGCCGCTTGTATCCAAATGTAC | CTTAGTTTGTTTTTATTTTTTTGAATATTA | ||||||
Mapping_target | CHROMOSOME_II | |||||||
Source_location | 225 | CHROMOSOME_II | 128001 | 147000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006640 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00023138 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00198534 | ||||||
WBGene00019613 | ||||||||
WBGene00000857 | ||||||||
WBGene00005081 | ||||||||
WBGene00197931 | ||||||||
WBGene00196427 | ||||||||
Transcript | T25D3.7 | |||||||
K10B4.5.1 | ||||||||
K10B4.8 | ||||||||
K10B4.6a.1 | ||||||||
K10B4.1.1 | ||||||||
K10B4.9 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |