WormBase Tree Display for Variation: WBVar02121032
expand all nodes | collapse all nodes | view schema
WBVar02121032 | Name | Public_name | WBVar02121032 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851955 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | ATAATTATTTTTTCTTTTTTGAATATTTAA | CTTACGATTTAAATTTCAAGCATCTCAACG | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 12723001 | 12741000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00011952 | ||||||
WBGene00003358 | ||||||||
WBGene00168234 | ||||||||
WBGene00004315 | ||||||||
WBGene00011951 | ||||||||
WBGene00045184 | ||||||||
WBGene00011950 | ||||||||
Transcript | T23F6.8 | |||||||
T23F6.3b.1 | ||||||||
T23F6.5.1 | ||||||||
T23F6.4b.1 | ||||||||
T23F6.3a.1 | ||||||||
T23F6.4a.1 | ||||||||
T23F6.6 | ||||||||
T23F6.3c.1 | ||||||||
T23F6.2.1 | ||||||||
Pseudogene | T23F6.7 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |