WormBase Tree Display for Variation: WBVar02121030
expand all nodes | collapse all nodes | view schema
WBVar02121030 | Name | Public_name | WBVar02121030 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851953 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | CAATTAAATTGAAAATAACAATAATAGGAA | GTCAATTGTGTAATTCAAGGTTACCCCAAG | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 11602001 | 11621000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
WBStrain00023018 | From_analysis | Million_mutation_project_reanalysis | ||||||
WBStrain00027662 | From_analysis | Million_mutation_project_reanalysis | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012499 | ||||||
WBGene00012497 | ||||||||
WBGene00001107 | ||||||||
WBGene00012498 | ||||||||
WBGene00004480 | ||||||||
WBGene00012496 | ||||||||
Transcript | Y24F12A.2b.1 | |||||||
Y24F12A.1a.1 | ||||||||
Y24F12A.1b.1 | ||||||||
F58B3.8.1 | ||||||||
Y24F12A.2a.1 | ||||||||
F40F11.1.1 | ||||||||
Pseudogene | Y24F12A.4 | |||||||
Y24F12A.3 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |