WormBase Tree Display for Variation: WBVar01474118
expand all nodes | collapse all nodes | view schema
WBVar01474118 | Name | Public_name | tm6234 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F35D2.5a.1:c.950+11_1616del | |||||||
F35D2.5c.1:c.152+11_818del | ||||||||
F35D2.5c.2:c.152+11_818del | ||||||||
HGVSg | CHROMOSOME_II:g.7588136_7589399del | |||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | ||||
Flanking_sequences | gatgacgtccttggagctctttgttctcca | cggaacaaacctttgatattgatgatcatg | ||||||
Mapping_target | R07G3 | |||||||
Source_location | 7 | CHROMOSOME_II | 7588135 | 7589400 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6234_external | |||||||
tm6234_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6234 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006363 | ||||||
Transcript | F35D2.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F35D2.5c.1:c.152+11_818del | |||||||
cDNA_position | ?-821 | |||||||
CDS_position | ?-818 | |||||||
Protein_position | ?-273 | |||||||
Intron_number | 2-5/10 | |||||||
Exon_number | 3-6/11 | |||||||
F35D2.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F35D2.5a.1:c.950+11_1616del | |||||||
cDNA_position | ?-1620 | |||||||
CDS_position | ?-1616 | |||||||
Protein_position | ?-539 | |||||||
Intron_number | 10-13/18 | |||||||
Exon_number | 11-14/19 | |||||||
F35D2.5c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F35D2.5c.2:c.152+11_818del | |||||||
cDNA_position | ?-1394 | |||||||
CDS_position | ?-818 | |||||||
Protein_position | ?-273 | |||||||
Intron_number | 7-10/15 | |||||||
Exon_number | 8-11/16 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | II | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 24635/24636-25899/25900 (1264 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Old Mapping_target F35D2 updated based on the VEP analysis pipeline to R07G3. | ||||||||
Method | NBP_knockout_allele |