WormBase Tree Display for Variation: WBVar01429656
expand all nodes | collapse all nodes | view schema
| WBVar01429656 | Evidence | Paper_evidence | WBPaper00041213 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | n4547 | |||||
| Other_name | Y43H11AL.3a.2:c.-12-3342_-12-2333del | ||||||
| HGVSg | CHROMOSOME_II:g.257527_258536del | ||||||
| Sequence_details | SMap | S_parent | Sequence | B0432 | |||
| Flanking_sequences | tttaaaaactatgtgaagtcacacctgtct | atcattttgaaaatccgacctttttgcgaa | |||||
| Mapping_target | B0432 | ||||||
| Type_of_mutation | Deletion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00027527 | ||||||
| Laboratory | MT | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004166 | |||||
| WBGene00000296 | |||||||
| Transcript (4) | |||||||
| Genetics | Interpolated_map_position | II | -15.6718 | ||||
| Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00041213 | |||
| Curator_confirmed | WBPerson461 | ||||||
| Remark | Figure 3. The locomotion rates of cat-2 mutants were more variable than those of wild-type animals; Figure 4. cat-2 mutants achieve greater peak acceleration, resulting in large fluctuations in the speed within tracks. | Paper_evidence | WBPaper00041213 | ||||
| Curator_confirmed | WBPerson461 | ||||||
| Disease_info | Models_disease | DOID:14330 | |||||
| Models_disease_in_annotation | WBDOannot00000970 | ||||||
| Reference | WBPaper00041213 | ||||||
| WBPaper00065310 | |||||||
| WBPaper00065715 | |||||||
| Method | Deletion_allele |
