WormBase Tree Display for Variation: WBVar01429538

WBVar01429538 Name: Public_name: tm5837
    HGVSg: CHROMOSOME_II:g.8566708_8567413del
  Sequence_details: SMap: S_parent: Sequence: F54C9
    Flanking_sequences: ttaaatttgtctcttttcgtttcagccgag aaaacaagtgttttctcgcagattttatta
    Mapping_target: F54C9
    Source_location: 7 CHROMOSOME_II 8566707 8567414 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5837_external
      tm5837_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5837
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00010041
    Transcript: F54C9.3.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-149
        CDS_position: ?-149
        Protein_position: ?-50
        Exon_number: 1/1
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 12582/12583-13288/13289 (706 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele