WormBase Tree Display for Variation: WBVar01282747
expand all nodes | collapse all nodes | view schema
| WBVar01282747 | Evidence | Paper_evidence | WBPaper00037807 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | cewivar00323347 | ||||||
| Other_name | F55A12.8.1:c.1404+17T>C | |||||||
| HGVSg | CHROMOSOME_I:g.5352156A>G | |||||||
| Sequence_details | SMap | S_parent | Sequence | F55A12 | ||||
| Flanking_sequences | CGATTGAGCCATTTTTCGATCTGAAATCATTTGTTACTACAACTAAATTT | AATTTGATTTTGGCACCTTATCTCCTGGCTTGTATCTGATACTTTCCTCC | ||||||
| Mapping_target | F55A12 | |||||||
| Type_of_mutation | Substitution | a | G | Paper_evidence | WBPaper00037807 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | SNP | |||||||
| Natural_variant | ||||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00006629 | From_analysis | Million_mutation_project_reanalysis | |||||
| WBStrain00022850 | From_analysis | Million_mutation_project_reanalysis | ||||||
| WGS_De_Bono | ||||||||
| WBStrain00023018 | From_analysis | Million_mutation_project_reanalysis | ||||||
| WBStrain00027652 | From_analysis | Million_mutation_project_reanalysis | ||||||
| Laboratory | AX | |||||||
| Analysis | WGS_De_Bono | |||||||
| Million_mutation_project_reanalysis | ||||||||
| DB_info | Database | dbSNP_ss | ss | 539142753 | ||||
| Status | Live | |||||||
| Affects | Gene | WBGene00018866 | ||||||
| Transcript | F55A12.8.1 | VEP_consequence | intron_variant | |||||
| VEP_impact | MODIFIER | |||||||
| HGVSc | F55A12.8.1:c.1404+17T>C | |||||||
| Intron_number | 6/13 | |||||||
| Description | Phenotype | WBPhenotype:0000356 | Paper_evidence | WBPaper00040608 | ||||
| Curator_confirmed | WBPerson6405 | |||||||
| Remark | Derived nath-10 allele in modern N2 leads to delayed spermatogenesis relative to allele present in ancestral N2. | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Phenotype_assay | Control_strain | WBStrain00000003 | Paper_evidence | WBPaper00040608 | ||||
| Curator_confirmed | WBPerson6405 | |||||||
| WBPhenotype:0000385 | Paper_evidence | WBPaper00040608 | ||||||
| Curator_confirmed | WBPerson6405 | |||||||
| Remark | Derived allele of nath-10 in modern N2 leads to increased total number of sperm produced in hermaphrodites relative to allele in ancestral N2. | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Phenotype_assay | Control_strain | WBStrain00000003 | Paper_evidence | WBPaper00040608 | ||||
| Curator_confirmed | WBPerson6405 | |||||||
| WBPhenotype:0002079 | Paper_evidence | WBPaper00040608 | ||||||
| Curator_confirmed | WBPerson6405 | |||||||
| Remark | Derived nath-10 allele in modern N2 leads to delayed reproductive maturity relative to the ancestral (wild) allele present in ancestral N2. | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00040608 | |||||
| Curator_confirmed | WBPerson6405 | |||||||
| Phenotype_assay | Control_strain | WBStrain00000003 | Paper_evidence | WBPaper00040608 | ||||
| Curator_confirmed | WBPerson6405 | |||||||
| Reference | WBPaper00040608 | |||||||
| WBPaper00037807 | ||||||||
| Remark | [2023-04-26T23:05:21.142Z WBPerson51134] Update Variation: https: | |||||||
| Method | WGS_De_Bono |
