WormBase Tree Display for Variation: WBVar00601579
expand all nodes | collapse all nodes | view schema
WBVar00601579 | Evidence | Paper_evidence | WBPaper00040453 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | qd101 | ||||||
Other_name | CE28367:p.Arg397Ter | |||||||
Y48G8AL.6.1:c.1189C>T | ||||||||
HGVSg | CHROMOSOME_I:g.1180357C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y48G8AL | ||||
Flanking_sequences | GACGTCGTCTGGAACGCCACCACCTTCGAG | GACAGTACAAGGCTCTTGCGGCGCTGCTCA | ||||||
Mapping_target | Y48G8AL | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00040453 | |||
Curator_confirmed | WBPerson51134 | |||||||
Remark | Resequenced and confirmed by WBPerson56105 | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | ZD | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004880 | ||||||
Transcript | Y48G8AL.6.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y48G8AL.6.1:c.1189C>T | |||||||
HGVSp | CE28367:p.Arg397Ter | |||||||
cDNA_position | 1191 | |||||||
CDS_position | 1189 | |||||||
Protein_position | 397 | |||||||
Exon_number | 5/11 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000534934 | |||||||
WBInteraction000536437 | ||||||||
Genetics | Interpolated_map_position | I | -16.9145 | |||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00040453 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We next examined the level of WT xbp-1 mRNA in the smg-2(qd101) mutant, and we observed that NMD inhibition increased the level of xbp-1 mRNA 2-fold relative to WT C. elegans (Figure 1C), which suggests that the NMD complex may function to decrease the level of WT xbp-1 mRNA." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000508 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | smg-2(qd101) resulted in accumulation of early stop codon-containing xbp-1 transcripts in the xbp-1(zc12) mutant background (Figure 1B) | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Whereas a 4 h exposure of the WT strain to P. aeruginosa PA14 causes a two-fold increase in spliced xbp-1 mRNA relative to exposure to the relatively non-pathogenic bacterial food Escherichia coli OP50 (Figure 3A and [21]), we observe a blunted response to P. aeruginosa infection in the smg-2(qd101) mutant (Figure 3A)." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000359 | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "... the loss of NMD did not increase the lethality of either the WT strain or xbp-1(zc12) mutant when grown in the presence of tunicamycin (Figure 1D)." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00040453 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | xbp-1(zc12) | Paper_evidence | WBPaper00040453 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001807 | Paper_evidence | WBPaper00049407 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | this smg-2 mutation did not result in the amplification of additional products not present in the wild-type sample, suggesting that this region of the daf-12 pre-mRNA is not subject to alternative splicing. | Paper_evidence | WBPaper00049407 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001834 | Paper_evidence | WBPaper00040453 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "... after exposing both the WT and smg-2(qd101) strains to tunicamycin for 4 h, the level of IRE-1-spliced xbp-1 mRNA was similar between the two strains (Figure 1C)." | Paper_evidence | WBPaper00040453 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004565 | Paper_evidence | WBPaper00040453 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00040453 | |||||||
WBPaper00049407 | ||||||||
Method | Substitution_allele |