WormBase Tree Display for Variation: WBVar00317308
expand all nodes | collapse all nodes | view schema
WBVar00317308 | Name | Public_name | tm4924 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C15H9.7.1:c.329+19_768+9delinsAAATTTTCGAAATTTTCGA | ||||||||
HGVSg | CHROMOSOME_X:g.6107950_6108470delinsTCGAAAATTTCGAAAATTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | C15H9 | |||||
Flanking_sequences | aaaagcgttagttttacagaaaatttcatt | caaaattaaaaaaccaacattttggcccat | |||||||
Mapping_target | C15H9 | ||||||||
Source_location | 7 | CHROMOSOME_X | 6107949 | 6108471 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | TCGAAAATTTCGAAAATTT | |||||||
Deletion | |||||||||
PCR_product | tm4924_external | ||||||||
tm4924_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030535 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 4924 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015802 | |||||||
Transcript | C15H9.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C15H9.7.1:c.329+19_768+9delinsAAATTTTCGAAATTTTCGA | ||||||||
Intron_number | 4-6/10 | ||||||||
Exon_number | 5-6/11 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0002357 | Paper_evidence | WBPaper00041487 | |||||
Curator_confirmed | WBPerson2582 | ||||||||
Remark | increased levels of 3-hydroxykynurenine/kynurenine | Paper_evidence | WBPaper00041487 | ||||||
Curator_confirmed | WBPerson2582 | ||||||||
EQ_annotations | Molecule_affected | WBMol:00005488 | PATO:0000460 | Paper_evidence | WBPaper00041487 | ||||
Curator_confirmed | WBPerson2582 | ||||||||
WBMol:00005489 | PATO:0000460 | Paper_evidence | WBPaper00041487 | ||||||
Curator_confirmed | WBPerson2582 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041487 | ||||||||
Remark | 19032/19033-TCGAAAATTTCGAAAATTT-19553/19554 (521 bp deletion + 19 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |