WormBase Tree Display for Variation: WBVar00296778

WBVar00296778 Evidence: Paper_evidence: WBPaper00037686
  Name: Public_name: e2977
    Other_name: CE39741:p.Gln112Ter
      JC8.12b.1:c.334C>T
      CE29812:p.Gln123Ter
      JC8.12a.1:c.367C>T
    HGVSg: CHROMOSOME_IV:g.13257276C>T
  Sequence_details: SMap: S_parent: Sequence: JC8
    Flanking_sequences: ctagtcggtctagctgccagaaatagacaa agagagtagatcagaataaaacctttataa
    Mapping_target: JC8
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004703
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00010442
    Transcript: JC8.12a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.12a.1:c.367C>T
        HGVSp: CE29812:p.Gln123Ter
        cDNA_position: 367
        CDS_position: 367
        Protein_position: 123
        Exon_number: 3/9
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      JC8.12b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.12b.1:c.334C>T
        HGVSp: CE39741:p.Gln112Ter
        cDNA_position: 334
        CDS_position: 334
        Protein_position: 112
        Exon_number: 2/8
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
  Genetics: Interpolated_map_position: IV 8.50462
  Description: Phenotype: WBPhenotype:0001012 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals are able to even less efficiently across bands of CBX120 (Bacillus pumilus) bacteria growth (hurdles) than wild type animals; almost all animals remain stuck at the first of three hurdles, while wild type worms can move through these bands, even through it is with great difficulty. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0001209 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit only a minor aspect of skiddy. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0001413 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: The Bus phenotype is more similar to br5 than to e2740. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0002159 Paper_evidence: WBPaper00045395
        Curator_confirmed: WBPerson499
      WBPhenotype:0002354 Paper_evidence: WBPaper00045395
        Curator_confirmed: WBPerson499
      WBPhenotype:0002462 Paper_evidence: WBPaper00045395
        Curator_confirmed: WBPerson499
        Remark: increased fungal spore adhesion Paper_evidence: WBPaper00045395
            Curator_confirmed: WBPerson499
      WBPhenotype:0004006 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Hermaphrodites experienced significantly reduced contact times by males during mating. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000031 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals did not exhibit any conspicuous difference from wild type. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
      WBPhenotype:0000145 Paper_evidence: WBPaper00037686
        Curator_confirmed: WBPerson712
        Remark: Animals did not exhibit any conspicuous differences from wild type. Paper_evidence: WBPaper00037686
            Curator_confirmed: WBPerson712
  Reference: WBPaper00037686
    WBPaper00045395
  Method: Substitution_allele