WormBase Tree Display for Variation: WBVar00296775
expand all nodes | collapse all nodes | view schema
WBVar00296775 | Evidence | Paper_evidence | WBPaper00037686 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e2974 | |||||
Other_name | JC8.12b.1:c.721C>A | ||||||
CE29812:p.Gln252Lys | |||||||
CE39741:p.Gln241Lys | |||||||
JC8.12a.1:c.754C>A | |||||||
HGVSg | CHROMOSOME_IV:g.13258404C>A | ||||||
Sequence_details | SMap | S_parent | Sequence | JC8 | |||
Flanking_sequences | tgtctcgagaagaatggtccattgaatatg | aaattgtgtcaaatgttcgtgcagttgttg | |||||
Mapping_target | JC8 | ||||||
Type_of_mutation | Substitution | c | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00010442 | |||||
Transcript | JC8.12a.1 | VEP_consequence | missense_variant | ||||
VEP_impact | MODERATE | ||||||
SIFT | 0.13 | tolerated | |||||
PolyPhen | 0.902 | possibly_damaging | |||||
HGVSc | JC8.12a.1:c.754C>A | ||||||
HGVSp | CE29812:p.Gln252Lys | ||||||
cDNA_position | 754 | ||||||
CDS_position | 754 | ||||||
Protein_position | 252 | ||||||
Exon_number | 7/9 | ||||||
Codon_change | Caa/Aaa | ||||||
Amino_acid_change | Q/K | ||||||
JC8.12b.1 (12) | |||||||
Genetics | Interpolated_map_position | IV | 8.50635 | ||||
Description | Phenotype | WBPhenotype:0001413 | Paper_evidence | WBPaper00037686 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | The Bus phenotype is more similar to br5 than to e2740. | Paper_evidence | WBPaper00037686 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00037686 | ||||||
Method | Substitution_allele |