WormBase Tree Display for Variation: WBVar00296477

WBVar00296477 Evidence: Paper_evidence: WBPaper00036467
  Name: Public_name: sy5411
    HGVSg: chrI:g.12641354_12641355insGC
  Sequence_details: SMap: S_parent: Sequence: cb25.fpc4122
    Flanking_sequences: aaactcgaaaaaatgtatccatcggcgcgc cagccgtacgtctgcaacgccaccacatcc
    Mapping_target: cb25.fpc4122
    Type_of_mutation: Insertion: gc Paper_evidence: WBPaper00036467
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis briggsae
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00038147
    Transcript: CBG18802.1 VEP_consequence: frameshift_variant
        VEP_impact: HIGH
        HGVSc: CBG18802.1:c.578_579insGC
        HGVSp: CBP41347.1:p.Gln194ProfsTer95
        cDNA_position: 578-579
        CDS_position: 578-579
        Protein_position: 193
        Exon_number: 5/11
        Codon_change: cgc/cgGCc
        Amino_acid_change: R/RX
  Description: Phenotype: WBPhenotype:0000165 Paper_evidence: WBPaper00036467
        Curator_confirmed: WBPerson712
        Remark: Uninduced P7.p and P8.p in pry-1 mutants are frequently unfused. Also some cases of unfused P(9-11).p were observed in pry-1 mutants. Paper_evidence: WBPaper00036467
            Curator_confirmed: WBPerson712
      WBPhenotype:0000218 Paper_evidence: WBPaper00036467
        Curator_confirmed: WBPerson712
        Remark: Animals showed a high frequency of ectopically induced VPCs. Specifically, mid-L4 stage animals showed a unique defect in VPC induction pattern; P3.p, P4.p, and P8.p were ectopically induced in most animals whereas P7.p remained uninduced. In some cases only P5.p and P6.p were induced. Paper_evidence: WBPaper00036467
            Curator_confirmed: WBPerson712
      WBPhenotype:0001792 Paper_evidence: WBPaper00036467
        Curator_confirmed: WBPerson712
        Remark: All P(7-11).p cell nuclei were significantly smaller in size compared to wild type, appearing similar to P12.pa. Paper_evidence: WBPaper00036467
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006776 PATO:0000460 Paper_evidence: WBPaper00036467
                Curator_confirmed: WBPerson712
            WBbt:0006777 PATO:0000460 Paper_evidence: WBPaper00036467
                Curator_confirmed: WBPerson712
            WBbt:0006778 PATO:0000460 Paper_evidence: WBPaper00036467
                Curator_confirmed: WBPerson712
            WBbt:0006779 PATO:0000460 Paper_evidence: WBPaper00036467
                Curator_confirmed: WBPerson712
            WBbt:0004410 PATO:0000460 Paper_evidence: WBPaper00036467
                Curator_confirmed: WBPerson712
  Reference: WBPaper00036467
  Method: Insertion_allele