WormBase Tree Display for Variation: WBVar00296477
expand all nodes | collapse all nodes | view schema
WBVar00296477 | Evidence | Paper_evidence | WBPaper00036467 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy5411 | |||||||
HGVSg | chrI:g.12641354_12641355insGC | ||||||||
Sequence_details | SMap | S_parent | Sequence | cb25.fpc4122 | |||||
Flanking_sequences | aaactcgaaaaaatgtatccatcggcgcgc | cagccgtacgtctgcaacgccaccacatcc | |||||||
Mapping_target | cb25.fpc4122 | ||||||||
Type_of_mutation | Insertion | gc | Paper_evidence | WBPaper00036467 | |||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis briggsae | |||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00038147 | |||||||
Transcript | CBG18802.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | CBG18802.1:c.578_579insGC | ||||||||
HGVSp | CBP41347.1:p.Gln194ProfsTer95 | ||||||||
cDNA_position | 578-579 | ||||||||
CDS_position | 578-579 | ||||||||
Protein_position | 193 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | cgc/cgGCc | ||||||||
Amino_acid_change | R/RX | ||||||||
Description | Phenotype | WBPhenotype:0000165 | Paper_evidence | WBPaper00036467 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Uninduced P7.p and P8.p in pry-1 mutants are frequently unfused. Also some cases of unfused P(9-11).p were observed in pry-1 mutants. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed a high frequency of ectopically induced VPCs. Specifically, mid-L4 stage animals showed a unique defect in VPC induction pattern; P3.p, P4.p, and P8.p were ectopically induced in most animals whereas P7.p remained uninduced. In some cases only P5.p and P6.p were induced. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001792 | Paper_evidence | WBPaper00036467 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All P(7-11).p cell nuclei were significantly smaller in size compared to wild type, appearing similar to P12.pa. | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006776 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006777 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006778 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006779 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004410 | PATO:0000460 | Paper_evidence | WBPaper00036467 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036467 | ||||||||
Method | Insertion_allele |