WormBase Tree Display for Variation: WBVar00275483

WBVar00275483 Evidence: Paper_evidence: WBPaper00030735
    Person_evidence: WBPerson75
  Name: Public_name: zu67
    Other_name: CE31239:p.Arg150Ter
      T19E7.2a.1:c.718C>T
      T19E7.2c.1:c.448C>T
      CE27591:p.Arg240Ter
    HGVSg: CHROMOSOME_IV:g.5653852G>A
  Sequence_details: SMap: S_parent: Sequence: T19E7
    Flanking_sequences: tttcagccactcactgccgaagagaatgct gatatgaagatctttcgaaaggattctata
    Mapping_target: T19E7
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00030735
            Person_evidence: WBPerson75
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005061
      WBStrain00005115
      WBStrain00007249
      WBStrain00007250
      WBStrain00007255
      WBStrain00022470
    Laboratory: JJ
    Status: Live
  Affects: Gene: WBGene00004804
    Transcript: T19E7.2a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T19E7.2a.1:c.718C>T
        HGVSp: CE27591:p.Arg240Ter
        cDNA_position: 718
        CDS_position: 718
        Protein_position: 240
        Exon_number: 4/9
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      T19E7.2c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: T19E7.2c.1:c.448C>T
        HGVSp: CE31239:p.Arg150Ter
        cDNA_position: 448
        CDS_position: 448
        Protein_position: 150
        Exon_number: 2/6
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
    Interactor (41)
  Genetics: Interpolated_map_position: IV 2.03219
    Mapping_data: In_multi_point: 1708
        1709
  Description: Phenotype (27)
    Phenotype_not_observed: WBPhenotype:0000215 Paper_evidence: WBPaper00001521
        Curator_confirmed: WBPerson2021
        Remark: In skn-1 embryos, the germline precursors appear normal Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00001521
          Curator_confirmed: WBPerson2021
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00001521
                Curator_confirmed: WBPerson2021
      WBPhenotype:0000306 Paper_evidence: WBPaper00043917
        Curator_confirmed: WBPerson2987
        Remark: "Therefore, we tested paraquat mediated hsp-6 induction in skn-1(zu67) mutant animals after RNAi with pas-4, and pas-7. Loss of function of SKN-1 did not reconstitute the paraquat mediated hsp-6 induction, which argues against such an indirect effect of the SKN-1 activating RNAi experiments." Paper_evidence: WBPaper00043917
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00043917
              Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: zcIs13 [Phsp-6::GFP]; pas-4(RNAi) or pas-7(RNAi) Paper_evidence: WBPaper00043917
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001278 Paper_evidence: WBPaper00043917
        Curator_confirmed: WBPerson2987
        Remark: "We therefore tested paraquat-induced expression of hsp-6::gfp in loss-of-function mutants of skn-1(zu67), daf-16(mu86) and hif-1(ia4). We found that none of the mutants prevented the induction of hsp-6 upon 0.5 mM paraquat exposure (Figure 5). This suggests that the response to paraquat triggers a pathway that does not require the transcription factors SKN-1, DAF-16 and HIF-1, and probably also not the pathways in which these factors are effectors namely the cytosolic stress response, insulin signaling, and the heat shock response." Paper_evidence: WBPaper00043917
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00043917
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001302 Paper_evidence: WBPaper00001521
        Curator_confirmed: WBPerson2021
        Remark: P-granules are properly segregated in skn-1 mutants Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00001521
          Curator_confirmed: WBPerson2021
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00001521
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: staining with anti-P granule antibody Paper_evidence: WBPaper00001521
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001642 Paper_evidence: WBPaper00001521
        Curator_confirmed: WBPerson2021
        Remark: Cleavage patterns of the early blastomeres in skn-1 embryos appear normal in terms of the orientation of the division axes, asymmetries in cell size, and the timing of cell divisions Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        Recessive: Paper_evidence: WBPaper00001521
          Curator_confirmed: WBPerson2021
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00001521
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000003 PATO:0000460 Paper_evidence: WBPaper00001521
                Curator_confirmed: WBPerson2021
  Reference (19)
  Method: Substitution_allele