WormBase Tree Display for Variation: WBVar00275483
expand all nodes | collapse all nodes | view schema
WBVar00275483 | Evidence | Paper_evidence | WBPaper00030735 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson75 | ||||||||
Name | Public_name | zu67 | |||||||
Other_name (4) | |||||||||
HGVSg | CHROMOSOME_IV:g.5653852G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19E7 | |||||
Flanking_sequences | tttcagccactcactgccgaagagaatgct | gatatgaagatctttcgaaaggattctata | |||||||
Mapping_target | T19E7 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030735 | ||||
Person_evidence | WBPerson75 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005061 | ||||||||
WBStrain00005115 | |||||||||
WBStrain00007249 | |||||||||
WBStrain00007250 | |||||||||
WBStrain00007255 | |||||||||
WBStrain00022470 | |||||||||
Laboratory | JJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004804 | |||||||
Transcript | T19E7.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19E7.2a.1:c.718C>T | ||||||||
HGVSp | CE27591:p.Arg240Ter | ||||||||
cDNA_position | 718 | ||||||||
CDS_position | 718 | ||||||||
Protein_position | 240 | ||||||||
Exon_number | 4/9 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
T19E7.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19E7.2c.1:c.448C>T | ||||||||
HGVSp | CE31239:p.Arg150Ter | ||||||||
cDNA_position | 448 | ||||||||
CDS_position | 448 | ||||||||
Protein_position | 150 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (41) | |||||||||
Genetics | Interpolated_map_position | IV | 2.03219 | ||||||
Mapping_data | In_multi_point | 1708 | |||||||
1709 | |||||||||
Description | Phenotype (27) | ||||||||
Phenotype_not_observed | WBPhenotype:0000215 | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In skn-1 embryos, the germline precursors appear normal | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00043917 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Therefore, we tested paraquat mediated hsp-6 induction in skn-1(zu67) mutant animals after RNAi with pas-4, and pas-7. Loss of function of SKN-1 did not reconstitute the paraquat mediated hsp-6 induction, which argues against such an indirect effect of the SKN-1 activating RNAi experiments." | Paper_evidence | WBPaper00043917 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00043917 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | zcIs13 [Phsp-6::GFP]; pas-4(RNAi) or pas-7(RNAi) | Paper_evidence | WBPaper00043917 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00043917 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We therefore tested paraquat-induced expression of hsp-6::gfp in loss-of-function mutants of skn-1(zu67), daf-16(mu86) and hif-1(ia4). We found that none of the mutants prevented the induction of hsp-6 upon 0.5 mM paraquat exposure (Figure 5). This suggests that the response to paraquat triggers a pathway that does not require the transcription factors SKN-1, DAF-16 and HIF-1, and probably also not the pathways in which these factors are effectors namely the cytosolic stress response, insulin signaling, and the heat shock response." | Paper_evidence | WBPaper00043917 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00043917 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001302 | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | P-granules are properly segregated in skn-1 mutants | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | staining with anti-P granule antibody | Paper_evidence | WBPaper00001521 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001642 | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Cleavage patterns of the early blastomeres in skn-1 embryos appear normal in terms of the orientation of the division axes, asymmetries in cell size, and the timing of cell divisions | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001521 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001521 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001521 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (19) | |||||||||
Method | Substitution_allele |