WormBase Tree Display for Variation: WBVar00275455

WBVar00275455 Evidence: Paper_evidence: WBPaper00005036
  Name: Public_name: zc12
    Other_name: R74.3.2:c.100C>T
      CE40514:p.Gln34Ter
      R74.3.1:c.100C>T
    HGVSg: CHROMOSOME_III:g.4194082C>T
  Sequence_details: SMap: S_parent: Sequence: R74
    Flanking_sequences: atggctcccaagcgtgcacttccaacagaa aagttgtcgcacaacttcttggcgatgata
    Mapping_target: R74
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00005036
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00034061
    Laboratory: SJ
    Status: Live
  Affects: Gene: WBGene00006959
    Transcript: R74.3.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R74.3.1:c.100C>T
        HGVSp: CE40514:p.Gln34Ter
        cDNA_position: 274
        CDS_position: 100
        Protein_position: 34
        Exon_number: 2/5
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      R74.3.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R74.3.2:c.100C>T
        HGVSp: CE40514:p.Gln34Ter
        cDNA_position: 262
        CDS_position: 100
        Protein_position: 34
        Exon_number: 2/6
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor (20)
  Genetics: Interpolated_map_position: III -3.69682
    Mapping_data: In_multi_point: 5012
  Description: Phenotype (21)
    Phenotype_not_observed: WBPhenotype:0000424 Paper_evidence: WBPaper00042060
        Curator_confirmed: WBPerson2987
        Remark: "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." (Antibody staining of UNC-38 was normal) Paper_evidence: WBPaper00042060
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000460 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "No difference in longevity between wild-type and xbp-1 mutants was seen upon treatment with paraquat, an agent that increases oxidative stress and does not activate the UPR-ER, demonstrating that xbp-1 mutant animals are specifically susceptible to ER stress (Figures S2A and S2B)." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00002747 Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Paper_evidence: WBPaper00032255
        Curator_confirmed: WBPerson712
        Remark: Wild type and mutant worms are healthy adults with similar appearance. Paper_evidence: WBPaper00032255
            Curator_confirmed: WBPerson712
      WBPhenotype:0000845 Paper_evidence: WBPaper00042060
        Curator_confirmed: WBPerson2987
        Remark: "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." Paper_evidence: WBPaper00042060
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001006 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "Importantly, pharyngeal pumping rates (indicative of food intake) were similar between these genotypes, and animals were still actively feeding at day 8 of adulthood (Figure S2D)." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
      WBPhenotype:0001013 Paper_evidence: WBPaper00032255
        Curator_confirmed: WBPerson712
        Remark: C. elegans lacking the UPR respond normally to attack by the pathogenic bacteria Pseudomonas aeruginosa, which does not make a PFT. Paper_evidence: WBPaper00032255
            Curator_confirmed: WBPerson712
      WBPhenotype:0001379 Paper_evidence: WBPaper00032255
        Curator_confirmed: WBPerson712
        Remark: The mutant xbp-1(zc12) has the same sensitivity as wild type to killing by either CuSO4 or H2O2. Paper_evidence: WBPaper00032255
            Curator_confirmed: WBPerson712
        Affected_by: Molecule: WBMol:00003937 Paper_evidence: WBPaper00032255
              Curator_confirmed: WBPerson712
            WBMol:00001695 Paper_evidence: WBPaper00032255
              Curator_confirmed: WBPerson712
      WBPhenotype:0001653 Paper_evidence: WBPaper00005432
        Curator_confirmed: WBPerson712
        Remark: Both wild-type and xbp-1 mutant animals tolerated cadmium exposure for extended periods of time. Paper_evidence: WBPaper00005432
            Curator_confirmed: WBPerson712
      WBPhenotype:0001990 Paper_evidence: WBPaper00037064
        Curator_confirmed: WBPerson2987
      WBPhenotype:0002423 Paper_evidence: WBPaper00037064
          WBPaper00049307
        Curator_confirmed: WBPerson2987
        Remark: "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... Also, unlike the case for TmP, neither atf-6 nor xbp-1 mutation blocked HP (Fig. 4C)." Paper_evidence: WBPaper00037064
            Curator_confirmed: WBPerson2987
          "Mutation of the ER-UPR genes ire-1 and xbp-1 did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3b) Paper_evidence: WBPaper00049307
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0001666 PATO:0000460 Paper_evidence: WBPaper00049307
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gcIs30 [Neuro-m-nonN-Nmnat1] Paper_evidence: WBPaper00049307
              Curator_confirmed: WBPerson2987
  Reference (17)
  Method: Substitution_allele