WormBase Tree Display for Variation: WBVar00275455
expand all nodes | collapse all nodes | view schema
WBVar00275455 | Evidence | Paper_evidence | WBPaper00005036 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | zc12 | |||||||
Other_name | R74.3.2:c.100C>T | ||||||||
CE40514:p.Gln34Ter | |||||||||
R74.3.1:c.100C>T | |||||||||
HGVSg | CHROMOSOME_III:g.4194082C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | R74 | |||||
Flanking_sequences | atggctcccaagcgtgcacttccaacagaa | aagttgtcgcacaacttcttggcgatgata | |||||||
Mapping_target | R74 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005036 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00034061 | ||||||||
Laboratory | SJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006959 | |||||||
Transcript | R74.3.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R74.3.1:c.100C>T | ||||||||
HGVSp | CE40514:p.Gln34Ter | ||||||||
cDNA_position | 274 | ||||||||
CDS_position | 100 | ||||||||
Protein_position | 34 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
R74.3.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R74.3.2:c.100C>T | ||||||||
HGVSp | CE40514:p.Gln34Ter | ||||||||
cDNA_position | 262 | ||||||||
CDS_position | 100 | ||||||||
Protein_position | 34 | ||||||||
Exon_number | 2/6 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (20) | |||||||||
Genetics | Interpolated_map_position | III | -3.69682 | ||||||
Mapping_data | In_multi_point | 5012 | |||||||
Description | Phenotype (21) | ||||||||
Phenotype_not_observed | WBPhenotype:0000424 | Paper_evidence | WBPaper00042060 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." (Antibody staining of UNC-38 was normal) | Paper_evidence | WBPaper00042060 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000460 | Paper_evidence | WBPaper00042524 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "No difference in longevity between wild-type and xbp-1 mutants was seen upon treatment with paraquat, an agent that increases oxidative stress and does not activate the UPR-ER, demonstrating that xbp-1 mutant animals are specifically susceptible to ER stress (Figures S2A and S2B)." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Wild type and mutant worms are healthy adults with similar appearance. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00042060 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutants of the two major components of the UPR pathway in C. elegans, ire-1 and xbp-1 (49), were fully sensitive to levamisole and had normal levels of L-AChRs at the NMJ based on immunostaining (Fig. S5 A and B)." | Paper_evidence | WBPaper00042060 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00042524 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Importantly, pharyngeal pumping rates (indicative of food intake) were similar between these genotypes, and animals were still actively feeding at day 8 of adulthood (Figure S2D)." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | C. elegans lacking the UPR respond normally to attack by the pathogenic bacteria Pseudomonas aeruginosa, which does not make a PFT. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001379 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The mutant xbp-1(zc12) has the same sensitivity as wild type to killing by either CuSO4 or H2O2. | Paper_evidence | WBPaper00032255 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003937 | Paper_evidence | WBPaper00032255 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00001695 | Paper_evidence | WBPaper00032255 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00005432 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both wild-type and xbp-1 mutant animals tolerated cadmium exposure for extended periods of time. | Paper_evidence | WBPaper00005432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00037064 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | |||||||
WBPaper00049307 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... Also, unlike the case for TmP, neither atf-6 nor xbp-1 mutation blocked HP (Fig. 4C)." | Paper_evidence | WBPaper00037064 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Mutation of the ER-UPR genes ire-1 and xbp-1 did not suppress Neuro-Nmnat1(gcIs30[Neuro-m-nonN-Nmnat1]) hypoxic survival." (Figure S3b) | Paper_evidence | WBPaper00049307 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0001666 | PATO:0000460 | Paper_evidence | WBPaper00049307 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gcIs30 [Neuro-m-nonN-Nmnat1] | Paper_evidence | WBPaper00049307 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (17) | |||||||||
Method | Substitution_allele |