WormBase Tree Display for Variation: WBVar00275207
expand all nodes | collapse all nodes | view schema
WBVar00275207 | Evidence | Paper_evidence | WBPaper00027020 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | x12 | ||||||
Other_name (33) | ||||||||
HGVSg | CHROMOSOME_I:g.14623012C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y105E8B | ||||
Flanking_sequences | cagatccgcaccgtctcatccagactgaag | aggtccgattcttttctgtgtagtagtctt | ||||||
Mapping_target | Y105E8B | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00027020 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (4) | ||||||||
Affects | Gene | WBGene00002978 | ||||||
Transcript (20) | ||||||||
Interactor | WBInteraction000052055 | |||||||
WBInteraction000052056 | ||||||||
WBInteraction000052057 | ||||||||
WBInteraction000052373 | ||||||||
WBInteraction000052374 | ||||||||
WBInteraction000052375 | ||||||||
WBInteraction000052376 | ||||||||
WBInteraction000052377 | ||||||||
WBInteraction000518956 | ||||||||
Genetics | Interpolated_map_position | I | 25.8116 | |||||
Mapping_data | In_2_point | 209 | ||||||
213 | ||||||||
214 | ||||||||
5106 | ||||||||
6076 | ||||||||
In_multi_point | 203 | |||||||
246 | ||||||||
577 | ||||||||
960 | ||||||||
1781 | ||||||||
2221 | ||||||||
2331 | ||||||||
3094 | ||||||||
3095 | ||||||||
In_pos_neg_data (15) | ||||||||
Description | Phenotype | WBPhenotype:0000022 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slightly long | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000421 | Paper_evidence | WBPaper00000484 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | Twitchers survive much better than wild-type on 0.1mM levamisole. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
grows well in 1 mM levamisole | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00000484 | ||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Phenotype_assay | Treatment | 0.1mM and 1mM levamisole | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000422 | Paper_evidence | WBPaper00000484 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | Muscle spasms of twitchers are greatly exacerbated on 1mM levamisole compared to 0.1mM drug or regular medium. | Paper_evidence | WBPaper00000484 | |||||
Curator_confirmed | WBPerson2021 | |||||||
mild twitcher phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | uncoordinated | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001599 | Paper_evidence | WBPaper00000484 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | 1mM ouabain | Paper_evidence | WBPaper00000484 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001852 | Paper_evidence | WBPaper00035074 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants are resistant to tribendimidine | Paper_evidence | WBPaper00035074 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00035074 | |||||||
WBPaper00002748 | ||||||||
WBPaper00014049 | ||||||||
WBPaper00017307 | ||||||||
WBPaper00000484 | ||||||||
WBPaper00015313 | ||||||||
WBPaper00016080 | ||||||||
WBPaper00022415 | ||||||||
Method | Substitution_allele |