WormBase Tree Display for Variation: WBVar00275049
expand all nodes | collapse all nodes | view schema
| WBVar00275049 | Evidence | Paper_evidence | WBPaper00026781 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ve33 | |||||
| Sequence_details | SMap | S_parent | Sequence | F56A12 | |||
| Flanking_sequences | ctagccgttagtccgatttgtgggcgccgc | cctctctagttccttctgactctcttgcac | |||||
| Mapping_target | F56A12 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00026781 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | RG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003039 | |||||
| Genetics | Interpolated_map_position | V | 6.2759 | ||||
| Reference | WBPaper00019714 | ||||||
| WBPaper00026424 | |||||||
| Remark | Allele lies 235bp upstream of gene and is likely to be an miRNA gene regulatory mutation. | Paper_evidence | WBPaper00026781 | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003039 Genomic_neighbourhood | Paper_evidence | WBPaper00026781 | |||||
| Method | Substitution_allele |
