WormBase Tree Display for Variation: WBVar00274949
expand all nodes | collapse all nodes | view schema
WBVar00274949 | Evidence | Paper_evidence | WBPaper00006381 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ut180 | |||||||
Other_name | CE01245:p.Lys164Glu | ||||||||
F21H11.3.1:c.490A>G | |||||||||
HGVSg | CHROMOSOME_III:g.5133543T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | F21H11 | |||||
Flanking_sequences | cattggatgtcaaaaggcgccaactttcac | aactcaaactcacaaataatatatcggata | |||||||
Mapping_target | F21H11 | ||||||||
Type_of_mutation | Substitution | a | g | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022191 | ||||||||
Laboratory | JC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006543 | |||||||
Transcript | F21H11.3.1 (12) | ||||||||
Genetics | Interpolated_map_position | III | -2.08995 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00029060 | ||||||||
Remark | |||||||||
Method | Substitution_allele |