WormBase Tree Display for Variation: WBVar00274912
expand all nodes | collapse all nodes | view schema
WBVar00274912 | Evidence | Paper_evidence | WBPaper00005583 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | um3 | ||||||
Other_name | T07A9.3.1:c.404+335_1024del | |||||||
T07A9.3.3:c.404+335_1024del | ||||||||
T07A9.3.2:c.404+335_1024del | ||||||||
HGVSg | CHROMOSOME_IV:g.406155_407412del | |||||||
Sequence_details | SMap | S_parent | Sequence | T07A9 | ||||
Flanking_sequences | aataataagtttattgctgacacttttcaa | ttaaggtacaacaattttagcactaaacaa | ||||||
Mapping_target | T07A9 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023465 | |||||||
WBStrain00023468 | ||||||||
WBStrain00055932 | ||||||||
WBStrain00055935 | ||||||||
Laboratory | KB | |||||||
JN | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002187 | ||||||
Transcript | T07A9.3.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T07A9.3.3:c.404+335_1024del | |||||||
cDNA_position | ?-1036 | |||||||
CDS_position | ?-1024 | |||||||
Protein_position | ?-342 | |||||||
Intron_number | 5-8/10 | |||||||
Exon_number | 6-9/11 | |||||||
T07A9.3.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07A9.3.2:c.404+335_1024del | |||||||
cDNA_position | ?-1145 | |||||||
CDS_position | ?-1024 | |||||||
Protein_position | ?-342 | |||||||
Intron_number | 6-9/11 | |||||||
Exon_number | 7-10/12 | |||||||
T07A9.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T07A9.3.1:c.404+335_1024del | |||||||
cDNA_position | ?-1111 | |||||||
CDS_position | ?-1024 | |||||||
Protein_position | ?-342 | |||||||
Intron_number | 6-9/11 | |||||||
Exon_number | 7-10/12 | |||||||
Interactor (25) | ||||||||
Genetics | Interpolated_map_position | IV | -26.1355 | |||||
Mapping_data | In_multi_point | 4454 | ||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000081 | Paper_evidence | WBPaper00049705 | |||||
Curator_confirmed | WBPerson34124 | |||||||
Remark | reduced survival after prolonged L1 arrest | Paper_evidence | WBPaper00049705 | |||||
Curator_confirmed | WBPerson34124 | |||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00043917 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Next, we tested whether in a kgb-1 mutant paraquat triggered hsp-6::gfp induction is relieved, as we have observed using elt-2 RNAi. In line with our hypothesis, RNAi of afts-1 or pifk-1, both in the kgb-1(+) control strain and in the kgb-1(um3) mutant, still blocked the paraquat-triggered hsp-6::gfp induction (Figure 10A, 10B)." | Paper_evidence | WBPaper00043917 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00043917 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | zcIs13 [Phsp-6::GFP]; afts-1(RNAi) or pifk-1(RNAi) | Paper_evidence | WBPaper00043917 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00038321 | |||||||
WBPaper00005583 | ||||||||
WBPaper00031869 | ||||||||
WBPaper00012507 | ||||||||
WBPaper00025272 | ||||||||
WBPaper00043917 | ||||||||
WBPaper00049705 | ||||||||
WBPaper00065802 | ||||||||
WBPaper00066032 | ||||||||
WBPaper00046151 | ||||||||
Remark | Deletion endpoints estimated from Fig. 2 in paper [krb 030609] | Paper_evidence | WBPaper00005583 | |||||
Method | Deletion_allele |