WormBase Tree Display for Variation: WBVar00266638
expand all nodes | collapse all nodes | view schema
WBVar00266638 | Evidence | Paper_evidence | WBPaper00004492 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson46176 | ||||||||
Name | Public_name | u282 | |||||||
Other_name | T14F9.5.1:c.241G>A | ||||||||
CE33318:p.Glu81Lys | |||||||||
HGVSg | CHROMOSOME_X:g.2229780C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T14F9 | |||||
Flanking_sequences | caacattcagcgtgttcattcttcggcgct | ccgttcatttgcagcacttcttctcattcg | |||||||
Mapping_target | T14F9 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035039 | ||||||||
Laboratory | TU | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003018 | |||||||
Transcript | T14F9.5.1 (12) | ||||||||
Interactor | WBInteraction000501653 | ||||||||
WBInteraction000501777 | |||||||||
Genetics | Interpolated_map_position | X | -16.0465 | ||||||
Mapping_data | In_multi_point | 2313 | |||||||
In_pos_neg_data | 5448 | ||||||||
5459 | |||||||||
5465 | |||||||||
Description | Phenotype | WBPhenotype:0000316 | Paper_evidence | WBPaper00001125 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PLM is not observed in these mutants. | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
touch-insensitive in tail | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00001125 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000529 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lack PLM, AVM, PVM neurons, hence touch-insensitive in tail | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0003832 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004086 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001333 | Paper_evidence | WBPaper00001125 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PLM is not observed in these mutants. Also a number of neurons are in unusual positions (immediately posterior to the pharynx and anterior to the anus). | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00001125 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00001125 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males cannot mate. | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001509 | Paper_evidence | WBPaper00004492 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | loss of nearly all rays | Paper_evidence | WBPaper00004492 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
stronger than e1926; 90% of males lack rays; also lack PLM, AVM, PVM neurons, hence touch-insensitive in tail | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000850 | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are sensitive to touch in the head. | Paper_evidence | WBPaper00001125 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00014772 | ||||||||
WBPaper00006052 | |||||||||
WBPaper00001125 | |||||||||
WBPaper00014514 | |||||||||
WBPaper00015464 | |||||||||
WBPaper00010912 | |||||||||
WBPaper00004492 | |||||||||
WBPaper00014063 | |||||||||
WBPaper00014229 | |||||||||
WBPaper00021037 | |||||||||
Remark | We sequenced the mutation in lin-32(u282). Miller and Portman, 2011 (PMID: 21917811) reported that u282 resulted in E(81)K, but the actual allele alteration is not listed in Wormbase. | Person_evidence | WBPerson46176 | ||||||
Curator_confirmed | WBPerson51134 | ||||||||
alt_det = g to a mut_det = E(81)K | Person_evidence | WBPerson46176 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Variation information submitted by WBPerson46176 on 2023-08-9_19:27:01 via the Allele submission form.Submitted data refers to CDS sequence. | Curator_confirmed | WBPerson51134 | |||||||
Method | Substitution_allele |