WormBase Tree Display for Variation: WBVar00266638
expand all nodes | collapse all nodes | view schema
WBVar00266638 | Evidence | Paper_evidence | WBPaper00004492 | |||||
---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson46176 | |||||||
Name | Public_name | u282 | ||||||
Other_name | T14F9.5.1:c.241G>A | |||||||
CE33318:p.Glu81Lys | ||||||||
HGVSg | CHROMOSOME_X:g.2229780C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T14F9 | ||||
Flanking_sequences | caacattcagcgtgttcattcttcggcgct | ccgttcatttgcagcacttcttctcattcg | ||||||
Mapping_target | T14F9 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035039 | |||||||
Laboratory | TU | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003018 | ||||||
Transcript | T14F9.5.1 (12) | |||||||
Interactor | WBInteraction000501653 | |||||||
WBInteraction000501777 | ||||||||
Genetics | Interpolated_map_position | X | -16.0465 | |||||
Mapping_data | In_multi_point | 2313 | ||||||
In_pos_neg_data | 5448 | |||||||
5459 | ||||||||
5465 | ||||||||
Description | Phenotype (5) | |||||||
Phenotype_not_observed | WBPhenotype:0000850 | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are sensitive to touch in the head. | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00014772 | |||||||
WBPaper00006052 | ||||||||
WBPaper00001125 | ||||||||
WBPaper00014514 | ||||||||
WBPaper00015464 | ||||||||
WBPaper00010912 | ||||||||
WBPaper00004492 | ||||||||
WBPaper00014063 | ||||||||
WBPaper00014229 | ||||||||
WBPaper00021037 | ||||||||
Remark | We sequenced the mutation in lin-32(u282). Miller and Portman, 2011 (PMID: 21917811) reported that u282 resulted in E(81)K, but the actual allele alteration is not listed in Wormbase. | Person_evidence | WBPerson46176 | |||||
Curator_confirmed | WBPerson51134 | |||||||
alt_det = g to a mut_det = E(81)K | Person_evidence | WBPerson46176 | ||||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson46176 on 2023-08-9_19:27:01 via the Allele submission form.Submitted data refers to CDS sequence. | Curator_confirmed | WBPerson51134 | ||||||
Method | Substitution_allele |