WormBase Tree Display for Variation: WBVar00266530
expand all nodes | collapse all nodes | view schema
| WBVar00266530 | Evidence | Paper_evidence | WBPaper00003414 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | u76 | |||||
| Other_name | C44B11.3.1:c.205G>A | ||||||
| CE24843:p.Asp69Asn | |||||||
| HGVSg | CHROMOSOME_III:g.3137548C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C44B11 | |||
| Flanking_sequences | ggacgtcatgtgccaagagccgtcatggtc | acttggagccaactgtcattggtgggggat | |||||
| Mapping_target | C44B11 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003414 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TU | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003175 | |||||
| Transcript | C44B11.3.1 (11) | ||||||
| Genetics | Interpolated_map_position | III | -7.48974 | ||||
| Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | |||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001676 | Paper_evidence | WBPaper00001125 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Touch cell processes have fewer or are missing large diameter microtubules compared to processes in control animals. | Paper_evidence | WBPaper00001125 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00001125 | ||||||
| WBPaper00003414 | |||||||
| Method | Substitution_allele |
