WormBase Tree Display for Variation: WBVar00266530
expand all nodes | collapse all nodes | view schema
WBVar00266530 | Evidence | Paper_evidence | WBPaper00003414 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | u76 | |||||
Other_name (2) | |||||||
HGVSg | CHROMOSOME_III:g.3137548C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C44B11 | |||
Flanking_sequences | ggacgtcatgtgccaagagccgtcatggtc | acttggagccaactgtcattggtgggggat | |||||
Mapping_target | C44B11 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003414 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TU | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003175 | |||||
Transcript | C44B11.3.1 (11) | ||||||
Genetics | Interpolated_map_position | III | -7.48974 | ||||
Description | Phenotype | WBPhenotype:0000315 | Paper_evidence | WBPaper00001125 | |||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001676 | Paper_evidence | WBPaper00001125 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Touch cell processes have fewer or are missing large diameter microtubules compared to processes in control animals. | Paper_evidence | WBPaper00001125 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00001125 | ||||||
WBPaper00003414 | |||||||
Method | Substitution_allele |