WormBase Tree Display for Variation: WBVar00252831

WBVar00252831 Name: Public_name: tm4326
    Other_name: CE42001:p.Ser229_Thr374delextTer?
      F25D7.5.1:c.683_1120del
    HGVSg: CHROMOSOME_I:g.10427552_10428130del
  Sequence_details: SMap: S_parent: Sequence: Y106G6H
    Flanking_sequences: atgacaaagatgaacttattttagaagtag atctacaatttcagagatttaatttctgga
    Mapping_target: Y106G6H
    Source_location: 7 CHROMOSOME_I 10427551 10428131 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4326_external
      tm4326_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4326
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00009114
    Transcript: F25D7.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Reclassified as homozygous viable by the National Bioresource Project of Japan; originally classified as lethal OR sterile. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00049001
  Remark: [Y106G6H] 394/395-[Y106G6H] 973/974 (579 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele