WormBase Tree Display for Variation: WBVar00252831
expand all nodes | collapse all nodes | view schema
WBVar00252831 | Name | Public_name | tm4326 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE42001:p.Ser229_Thr374delextTer? | |||||||
F25D7.5.1:c.683_1120del | ||||||||
HGVSg | CHROMOSOME_I:g.10427552_10428130del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y106G6H | ||||
Flanking_sequences | atgacaaagatgaacttattttagaagtag | atctacaatttcagagatttaatttctgga | ||||||
Mapping_target | Y106G6H | |||||||
Source_location | 7 | CHROMOSOME_I | 10427551 | 10428131 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm4326_external | |||||||
tm4326_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4326 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00009114 | ||||||
Transcript | F25D7.5.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Reclassified as homozygous viable by the National Bioresource Project of Japan; originally classified as lethal OR sterile. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00049001 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |