WormBase Tree Display for Variation: WBVar00252400
expand all nodes | collapse all nodes | view schema
WBVar00252400 | Name | Public_name | tm3793 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK1098.10a.2:c.2578+74_2579del | |||||||
ZK1098.10o.1:c.1699+74_1700del | ||||||||
ZK1098.10a.1:c.2578+74_2579del | ||||||||
ZK1098.10g.1:c.1681+74_1682del | ||||||||
ZK1098.10e.1:c.2731+74_2732del | ||||||||
ZK1098.10f.1:c.1885+74_1886del | ||||||||
ZK1098.10b.1:c.2632+74_2633del | ||||||||
ZK1098.10p.1:c.883+74_884del | ||||||||
ZK1098.10c.1:c.799+74_800del | ||||||||
ZK1098.10d.1:c.2716+74_2717del | ||||||||
HGVSg | CHROMOSOME_III:g.9554910_9555122del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1098 | ||||
Flanking_sequences | aagctcaagacgtaagtactattcaaaata | cggtgaatggtccgacgaaggatatcattc | ||||||
Mapping_target | ZK1098 | |||||||
Source_location | 7 | CHROMOSOME_III | 9554909 | 9555123 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3793_external | |||||||
tm3793_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3793 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006755 | ||||||
Transcript | ZK1098.10g.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10g.1:c.1681+74_1682del | |||||||
cDNA_position | ?-1682 | |||||||
CDS_position | ?-1682 | |||||||
Protein_position | ?-561 | |||||||
Intron_number | 10/13 | |||||||
Exon_number | 11/14 | |||||||
ZK1098.10b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10b.1:c.2632+74_2633del | |||||||
cDNA_position | ?-2697 | |||||||
CDS_position | ?-2633 | |||||||
Protein_position | ?-878 | |||||||
Intron_number | 17/21 | |||||||
Exon_number | 18/22 | |||||||
ZK1098.10a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10a.2:c.2578+74_2579del | |||||||
cDNA_position | ?-2723 | |||||||
CDS_position | ?-2579 | |||||||
Protein_position | ?-860 | |||||||
Intron_number | 18/22 | |||||||
Exon_number | 19/23 | |||||||
ZK1098.10o.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10o.1:c.1699+74_1700del | |||||||
cDNA_position | ?-1700 | |||||||
CDS_position | ?-1700 | |||||||
Protein_position | ?-567 | |||||||
Intron_number | 11/14 | |||||||
Exon_number | 12/15 | |||||||
ZK1098.10a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10a.1:c.2578+74_2579del | |||||||
cDNA_position | ?-2788 | |||||||
CDS_position | ?-2579 | |||||||
Protein_position | ?-860 | |||||||
Intron_number | 19/23 | |||||||
Exon_number | 20/24 | |||||||
ZK1098.10f.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10f.1:c.1885+74_1886del | |||||||
cDNA_position | ?-1886 | |||||||
CDS_position | ?-1886 | |||||||
Protein_position | ?-629 | |||||||
Intron_number | 12/15 | |||||||
Exon_number | 13/16 | |||||||
ZK1098.10e.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10e.1:c.2731+74_2732del | |||||||
cDNA_position | ?-2796 | |||||||
CDS_position | ?-2732 | |||||||
Protein_position | ?-911 | |||||||
Intron_number | 18/22 | |||||||
Exon_number | 19/23 | |||||||
ZK1098.10p.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10p.1:c.883+74_884del | |||||||
cDNA_position | ?-884 | |||||||
CDS_position | ?-884 | |||||||
Protein_position | ?-295 | |||||||
Intron_number | 7/10 | |||||||
Exon_number | 8/11 | |||||||
ZK1098.10c.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10c.1:c.799+74_800del | |||||||
cDNA_position | ?-800 | |||||||
CDS_position | ?-800 | |||||||
Protein_position | ?-267 | |||||||
Intron_number | 6/9 | |||||||
Exon_number | 7/10 | |||||||
ZK1098.10d.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK1098.10d.1:c.2716+74_2717del | |||||||
cDNA_position | ?-2781 | |||||||
CDS_position | ?-2717 | |||||||
Protein_position | ?-906 | |||||||
Intron_number | 18/22 | |||||||
Exon_number | 19/23 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000001 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Miller: normal posture. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KG | |||||||
WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Miller: non-Gro. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KG | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Miller: homozygous viable. Originally classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KG | |||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Miller: non-Egl. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KG | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. K. Miller: non-Unc. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KG | |||||||
Remark | 34996/34997-35209/35210 (213 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |