WormBase Tree Display for Variation: WBVar00252326
expand all nodes | collapse all nodes | view schema
WBVar00252326 | Name | Public_name | tm3713 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F29B9.2c.1:c.534_943+1del | |||||||
F29B9.2b.1:c.438_847+1del | ||||||||
F29B9.2a.1:c.477_886+1del | ||||||||
HGVSg | CHROMOSOME_IV:g.4661635_4662209del | |||||||
Sequence_details | SMap | S_parent | Sequence | F29B9 | ||||
Flanking_sequences | ggagtcaaatcagaactacgtcagcaacgg | taagttttttcatcgaatagcttgcaatta | ||||||
Mapping_target | F29B9 | |||||||
Source_location | 7 | CHROMOSOME_IV | 4661634 | 4662210 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3713_external | |||||||
tm3713_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3713 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00017920 | ||||||
Transcript | F29B9.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F29B9.2c.1:c.534_943+1del | |||||||
cDNA_position | 534-? | |||||||
CDS_position | 534-? | |||||||
Protein_position | 178-? | |||||||
Intron_number | 3-4/9 | |||||||
Exon_number | 3-4/10 | |||||||
F29B9.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F29B9.2b.1:c.438_847+1del | |||||||
cDNA_position | 456-? | |||||||
CDS_position | 438-? | |||||||
Protein_position | 146-? | |||||||
Intron_number | 4-5/11 | |||||||
Exon_number | 4-5/12 | |||||||
F29B9.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F29B9.2a.1:c.477_886+1del | |||||||
cDNA_position | 495-? | |||||||
CDS_position | 477-? | |||||||
Protein_position | 159-? | |||||||
Intron_number | 5-6/12 | |||||||
Exon_number | 5-6/13 | |||||||
Interactor | WBInteraction000521428 | |||||||
WBInteraction000521429 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0002078 | Paper_evidence | WBPaper00036110 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | F29B9.2(tm3713) mutant animals showed an increase in global levels of H3K9me2 and H3K27me2, compared to wild-type animals. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0004024 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | F29B9.2(tm3713) mutant animals showed defects in body movement. Wild-type N2 animals moved by alternating dorsal and ventral flexions along the body length, producing a regular sinusoidal track on bacteria. In contrast to this, the track pattern left by tm3713 was irregular, with increased wavelength (distance between successive peaks of a wave) but unchanged amplitude of the wave. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as 'homozygous viable' by the National Bioresource Project of Japan. Comment to the NBP from Dr. A. Salcini: Mol Cell. 38, 165 (2010). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Data not shown. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Data not shown. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000680 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Data not shown. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000845 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Data not shown. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0001232 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Data not shown. | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002168 | Paper_evidence | WBPaper00045092 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Dye filling in sensory neurons normal (data not shown). | Paper_evidence | WBPaper00036110 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00036110 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Disease_info | Models_disease | DOID:0060309 | ||||||
Models_disease_in_annotation | WBDOannot00000447 | |||||||
Reference | WBPaper00036110 | |||||||
WBPaper00045092 | ||||||||
Remark | 15767/15768-16342/16343 (575 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |