WormBase Tree Display for Variation: WBVar00251849
expand all nodes | collapse all nodes | view schema
WBVar00251849 | Name | Public_name | tm3067 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | C05C8.9b.2:c.-43_345del | |||||||
C05C8.9a.1:c.-43_345del | ||||||||
C05C8.9b.1:c.-43_345del | ||||||||
HGVSg | CHROMOSOME_V:g.7237515_7238007del | |||||||
Sequence_details | SMap | S_parent | Sequence | C05C8 | ||||
Flanking_sequences | gtagtttaacgtgtacgtcatttcctcctt | cctgagagaaaccttctggtcgatcgagcg | ||||||
Mapping_target | C05C8 | |||||||
Source_location | 7 | CHROMOSOME_V | 7237514 | 7238008 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm3067_external | |||||||
tm3067_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3067 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015466 | ||||||
Transcript | C05C8.9b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C05C8.9b.1:c.-43_345del | |||||||
cDNA_position | 103-490 | |||||||
CDS_position | ?-345 | |||||||
Protein_position | ?-115 | |||||||
Intron_number | 2-3/5 | |||||||
Exon_number | 1-4/6 | |||||||
C05C8.9a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C05C8.9a.1:c.-43_345del | |||||||
cDNA_position | 135-522 | |||||||
CDS_position | ?-345 | |||||||
Protein_position | ?-115 | |||||||
Intron_number | 2-3/6 | |||||||
Exon_number | 1-4/7 | |||||||
C05C8.9b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C05C8.9b.2:c.-43_345del | |||||||
cDNA_position | 100-487 | |||||||
CDS_position | ?-345 | |||||||
Protein_position | ?-115 | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 1-4/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000238 | Paper_evidence | WBPaper00035062 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Foraging behavior was reduced compared to control | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Chemotaxis to isoamyl alcohol was reduced compared to control | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000310 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Residual cilia were not associated with a particular type of neuron; The ASER neuron lacks ciliary projections | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Punctate HYLS-1 staining was absent in hyls-1deletion worms | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | CHE-11:GFP fails to accumulate at the transition zone of hyls-1 mutants | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Male mating efficiency was reduced compared to control | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00035062 | ||||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In hyls-1 mutant animals, only 10% of the normal number of ciliated neurons were observed to dye-fill | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Comment to the National Bioresource of Japan from Dr. O. Blacque: partially Dyf. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | OEB | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00035062 | |||||
Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. Comment to the NBP from Dr. K. Oegema: Genes & Dev. 23, 2046 (2009). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
OD | ||||||||
hyls-1 mutant embryos were viable | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hyls-1 mutant embryos developed into fertile adults | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000853 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | IFT is unchanged in residual cilia of hyls-1 mutant animals | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001333 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Neuron-specific GFP reporters confirmed normal presence of the amphid and phasmid neurons in hyls-1 mutants | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001588 | Paper_evidence | WBPaper00035062 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hyls-1 mutant embryos did not show centriole duplication defects | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035062 | |||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:0050779 | ||||||
Models_disease_in_annotation | WBDOannot00000206 | |||||||
Reference | WBPaper00035062 | |||||||
Remark | 13498/13499-13991/13992 (493 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |