WormBase Tree Display for Variation: WBVar00251611
expand all nodes | collapse all nodes | view schema
WBVar00251611 | Name | Public_name | tm2775 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.7363294_7363521del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F08F8 | |||||
Flanking_sequences | tattctatttatatgaaaaataagtttattttttaacgtttattataaaaaacagtttttaaaattattcaaaaaagtacatgaaaataagtagtggaatgaattgagaacattgaatactacttttgaaagaataattataaaataagaatgaaaaatgagataattaacatcgaccaaatctgcgttcaaatggatgttgtctcttgaatccatgatgtccgaatccatgaccaaatccatgatgatgaccaccgaatccatggaatgctccaaatggatgatgatgtctatggaaattgaatccatgatgatccattcctcgtcttccaaatggtcttccgaatcctccagttggaccttcaaattcttctcttccacaaggtgttccaaatgatcctaatggatgtcttttgaattcttctccttcacgacatggtcttcttccaattggtgatgctgatcttgcacgtcttccaccaaaacagtgacgtcttttgaattctggatgtccatgggattcttggaatcttttccacatgagcttcttcatttgatgtctcttgtgatgatcatggaaatttgaacgacttctgcttcgagatcttgaacgatcaaatccacgacttctggatctatcacgtcttccacaatgacgacgatgtggagctacttcaggagcatcagcaataatgacatcttcatctccagaatcagaagaatcagatgaagaatccgatgaatcagaatcagcaatcacaaaaatagaagcagaatctctgttagccatctttttcagaactctctgagcattctgagacattgaaatcaaatttccttt | ctccgcctaccagctgtccctgaactatttcgaaattgtttaatgtgtctgtgtctatcgaaataatacgaaaatgtactgtcatcactgtctgcgtctcgaattggcgctgatcttttgatattcattgatgaatgagactagagacatggatgtattgcacaaaccacagaaagagcacaaagtctttgaatttcagatgatctgaaatacatcgacatcaatagagatttacttcttaggtgacatt | |||||||
Mapping_target | F08F8 | ||||||||
Source_location | 7 | CHROMOSOME_III | 7363293 | 7363522 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm2775_external | ||||||||
tm2775_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (6) | |||||||||
Affects | Gene | WBGene00017270 | |||||||
Transcript | F08F8.5.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-171 | ||||||||
CDS_position | ?-171 | ||||||||
Protein_position | ?-57 | ||||||||
Exon_number | 1/1 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | numr-1(tm2775) nematodes were egg-laying defective (Egl phenotype). This was demonstrated by an increase in the number of nematodes with a "bagging" phenotype, where nematodes fail to lay their eggs and embryos hatch inside the parent (Figure 6). | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00036303 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Microscopic examination of the vulva in L4 numr-1(tm2775) nematodes showed that there were structural abnormalities, which may have contributed to the Egl phenotype (Figure 6). numr-1(tm2775) nematodes often lacked organized epithelial-ring structures that line the vulva lumen at the L4 stage. | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00036303 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002241 | Paper_evidence | WBPaper00036303 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | numr-1(tm2775) nematodes did not feed as much (i.e. Eat phenotype) as the wild-type nematodes (Figure 6). | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Briefly, 25 adult C. elegans were dispensed into each well of a 96-well plate, containing K-medium and OP50 E. coli, using a COPAS Biosort (Union Biometrica Inc., Somerville, MA, USA). After 4 hours, Fluoresbrite polychromatic red microspheres (Polysciences, Inc., Warrington, PA) were added into each well and mixed for 5 minutes. Nematodes were allowed to ingest the microspheres for 10 additional minutes and then anesthetized by adding sodium azide (10 millimolar final concentration) to prevent additional bead ingestion. The size and level of fluorescence of individual C. elegans were measured. | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Reference | WBPaper00036303 | ||||||||
Remark | 24319/24320-24547/24548 (228 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |