WormBase Tree Display for Variation: WBVar00251563
expand all nodes | collapse all nodes | view schema
WBVar00251563 | Name | Public_name | tm2718 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y54E10A.2.1:c.1565+2350_1565+2784del | |||||||
Y54E10A.16.1:c.636_1023del | ||||||||
CE24445:p.Ile212MetfsTer48 | ||||||||
HGVSg | CHROMOSOME_I:g.3244834_3245268del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y54E10A | ||||
Flanking_sequences | ctgttggccgaatcgctccatgaatgagtc | atgaagaatttgttgagcggcattcgggaa | ||||||
Mapping_target | Y54E10A | |||||||
Source_location | 7 | CHROMOSOME_I | 3244833 | 3245269 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2718_external | |||||||
tm2718_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2718 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021834 | ||||||
WBGene00003258 | ||||||||
Transcript | Y54E10A.2.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y54E10A.2.1:c.1565+2350_1565+2784del | |||||||
Intron_number | 9/15 | |||||||
Y54E10A.16.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00036735 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit fusions of rays 4-5 (17%), rays 6-7 (60%) and rays 8-9(31%). Although structural processes were fused, neuronal processes were well separated. | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In response to anterior touch, backward movement of males is uncoordinated. | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00036735 | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |