WormBase Tree Display for Variation: WBVar00251563
expand all nodes | collapse all nodes | view schema
WBVar00251563 | Name (3) | |||||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | Y54E10A | ||||
Flanking_sequences | ctgttggccgaatcgctccatgaatgagtc | atgaagaatttgttgagcggcattcgggaa | ||||||
Mapping_target | Y54E10A | |||||||
Source_location | 7 | CHROMOSOME_I | 3244833 | 3245269 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2718_external | |||||||
tm2718_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2718 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021834 | ||||||
WBGene00003258 | ||||||||
Transcript | Y54E10A.2.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | Y54E10A.2.1:c.1565+2350_1565+2784del | |||||||
Intron_number | 9/15 | |||||||
Y54E10A.16.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00036735 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000296 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000297 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit fusions of rays 4-5 (17%), rays 6-7 (60%) and rays 8-9(31%). Although structural processes were fused, neuronal processes were well separated. | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In response to anterior touch, backward movement of males is uncoordinated. | Paper_evidence | WBPaper00036735 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00036735 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00036735 | |||||||
Remark | 85243/85244-85678/85679 (435 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |