WormBase Tree Display for Variation: WBVar00251563

WBVar00251563 Name: Public_name: tm2718
    Other_name: Y54E10A.2.1:c.1565+2350_1565+2784del
      Y54E10A.16.1:c.636_1023del
      CE24445:p.Ile212MetfsTer48
    HGVSg: CHROMOSOME_I:g.3244834_3245268del
  Sequence_details: SMap: S_parent: Sequence: Y54E10A
    Flanking_sequences: ctgttggccgaatcgctccatgaatgagtc atgaagaatttgttgagcggcattcgggaa
    Mapping_target: Y54E10A
    Source_location: 7 CHROMOSOME_I 3244833 3245269 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2718_external
      tm2718_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2718
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021834
      WBGene00003258
    Transcript: Y54E10A.2.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y54E10A.2.1:c.1565+2350_1565+2784del
        Intron_number: 9/15
      Y54E10A.16.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description (2)
  Reference: WBPaper00036735
  Remark: 85243/85244-85678/85679 (435 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele