WormBase Tree Display for Variation: WBVar00251499

WBVar00251499 Name: Public_name: tm2650
    Other_name: Y59A8B.8.1:c.236+4_319del
    HGVSg: CHROMOSOME_V:g.18065192_18065405del
  Sequence_details: SMap: S_parent: Sequence: Y59A8B
    Flanking_sequences: ccgtatcgagacttccactctccgcataac tactttgcagcgtggaataaatttcgattc
    Mapping_target: Y59A8B
    Source_location: 7 CHROMOSOME_V 18065191 18065406 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2650_external
      tm2650_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2650
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00305843
      WBGene00013345
    Transcript: Y59A8B.42
      Y59A8B.8.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y59A8B.8.1:c.236+4_319del
        cDNA_position: ?-321
        CDS_position: ?-319
        Protein_position: ?-107
        Intron_number: 3/7
        Exon_number: 4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Classified as 'homozygous viable' by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
            Laboratory_evidence: FX
  Remark: 135637/135638-135851/135852 (214 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele