WormBase Tree Display for Variation: WBVar00251475

WBVar00251475 Name: Public_name: tm2621
    Other_name: H04M03.4.1:c.477_747+12del
    HGVSg: CHROMOSOME_IV:g.5887595_5887877del
  Sequence_details: SMap: S_parent: Sequence: H04M03
    Flanking_sequences: atgggttctccaacactttggaccaacaat tgttttttgcgtgaagtgaattttctttga
    Mapping_target: H04M03
    Source_location: 7 CHROMOSOME_IV 5887594 5887878 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2621_external
      tm2621_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2621
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019154
    Transcript: H04M03.4.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: H04M03.4.1:c.477_747+12del
        cDNA_position: 478-?
        CDS_position: 477-?
        Protein_position: 159-?
        Intron_number: 4/8
        Exon_number: 4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype (18)
  Reference: WBPaper00035194
  Remark: 16853/16854-17136/17137 (283 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele