WormBase Tree Display for Variation: WBVar00251286

WBVar00251286 Name: Public_name: tm2398
    Other_name: CE16606:p.Ile136_Gly206delextTer?
      Y22F5A.5.1:c.406_618del
    HGVSg: CHROMOSOME_V:g.10280590_10281039del
  Sequence_details: SMap: S_parent: Sequence: Y22F5A
    Flanking_sequences: agttggctttgtctctccagaagtaccacc agtgattccattattgttgagtccgttata
    Mapping_target: Y22F5A
    Source_location: 7 CHROMOSOME_V 10280589 10281040 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2398_external
      tm2398_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2398
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003091
    Transcript: Y22F5A.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000738 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. M. Herman: life span change by some bacteria. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KS
      WBPhenotype:0001013 Paper_evidence: WBPaper00040209
        Curator_confirmed: WBPerson712
        Remark: Knock-out mutations resulted in significantly reduced resistance measures during exposure to pathogenic Bt (Bacillus thuringiensis). Paper_evidence: WBPaper00040209
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000231 Paper_evidence: WBPaper00040209
        Curator_confirmed: WBPerson712
        Remark: On pathogenic Bt, the mutants did not significantly differ from the wild-type. Paper_evidence: WBPaper00040209
            Curator_confirmed: WBPerson712
      WBPhenotype:0000659 Paper_evidence: WBPaper00040209
        Curator_confirmed: WBPerson712
        Remark: On pathogenic Bt, the mutants did not significantly differ from the wild-type. Paper_evidence: WBPaper00040209
            Curator_confirmed: WBPerson712
      WBPhenotype:0000673 Paper_evidence: WBPaper00040209
        Curator_confirmed: WBPerson712
        Remark: On pathogenic Bt, the mutants did not significantly differ from the wild-type. Paper_evidence: WBPaper00040209
            Curator_confirmed: WBPerson712
      WBPhenotype:0001819 Paper_evidence: WBPaper00040209
        Curator_confirmed: WBPerson712
        Remark: Mutants did not suffer from a significantly higher infection load than N2. Paper_evidence: WBPaper00040209
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040209
  Remark: 26508/26509-26958/26959 (450 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele