WormBase Tree Display for Variation: WBVar00251254

WBVar00251254 Name: Public_name: tm2359
    HGVSg
  Sequence_details: SMap: S_parent: Sequence: Y48C3A
    Flanking_sequences: aaaaaaaagagaaaaaaatgaaaaaaaaaa tgacgtcatcaatgtgctcgaggggctcgg
    Mapping_target: Y48C3A
    Source_location: 7 CHROMOSOME_II 13406053 13406384 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TTTCCAAATTTTTGGATGTNNCGNCCCCTTTGNGAAAATTTTTCTTT
      Deletion
    PCR_product: tm2359_external
      tm2359_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2359
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00305764
      WBGene00001162
    Transcript: Y48C3A.17d.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-244
        CDS_position: ?-224
        Protein_position: ?-75
        Exon_number: 1-2/7
      Y48C3A.26
      Y48C3A.17b.1 VEP_consequence: coding_sequence_variant,5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-244
        CDS_position: ?-224
        Protein_position: ?-75
        Exon_number: 1-2/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000640 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. J. Kaplan: non-Egl. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the NBP from Dr. J. Kaplan: non-Unc. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KP
  Remark: 150519/150520-TTTCCAAATTTTTGGATGTNNCGNCCCCTTTGNGAAAATTTTTCTTT-150849/150850 (330 bp deletion + 47 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele