WormBase Tree Display for Variation: WBVar00251178

WBVar00251178 Name: Public_name: tm2267
    Other_name: Y40G12A.2.1:c.441_619del
      CE52436:p.His148GlnfsTer42
    HGVSg: CHROMOSOME_V:g.6509050_6509278del
  Sequence_details: SMap: S_parent: Sequence: F46E10
    Flanking_sequences: gcttttgcacattgtccatgagatctttga gcttcggcaagatcagtgtctgaaattttt
    Mapping_target: F46E10
    Source_location: 7 CHROMOSOME_V 6509049 6509279 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm2267_external
      tm2267_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2267
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006722
    Transcript: Y40G12A.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Inoue: normal locomotion Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000650 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Inoue: normal defecation. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 2239/2240-2468/2469 (229 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target Y40G12A updated based on the VEP analysis pipeline to F46E10.
  Method: NBP_knockout_allele