WormBase Tree Display for Variation: WBVar00251069
expand all nodes | collapse all nodes | view schema
WBVar00251069 | Name | Public_name | tm2130 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y59A8B.11c.1:c.47-216_693del | |||||||
Y59A8B.11a.3:c.-26-216_666del | ||||||||
Y59A8B.11a.1:c.-24-218_666del | ||||||||
Y59A8B.11b.1:c.47-216_738del | ||||||||
Y59A8B.11a.4:c.-26-216_666del | ||||||||
Y59A8B.11a.2:c.-242_666del | ||||||||
HGVSg | CHROMOSOME_V:g.18082731_18083687del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | ||||
Flanking_sequences | tttaacagcatcagcgacagaaagatacgc | agtaataaaaaattcttcaaagtttggtac | ||||||
Mapping_target | Y59A8B | |||||||
Source_location | 7 | CHROMOSOME_V | 18082730 | 18083688 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2130_external | |||||||
tm2130_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2130 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013348 | ||||||
Transcript | Y59A8B.11c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11c.1:c.47-216_693del | |||||||
cDNA_position | ?-765 | |||||||
CDS_position | ?-693 | |||||||
Protein_position | ?-231 | |||||||
Intron_number | 2-4/6 | |||||||
Exon_number | 3-5/7 | |||||||
Y59A8B.11a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11a.1:c.-24-218_666del | |||||||
cDNA_position | ?-809 | |||||||
CDS_position | ?-666 | |||||||
Protein_position | ?-222 | |||||||
Intron_number | 1-3/5 | |||||||
Exon_number | 2-4/6 | |||||||
Y59A8B.11a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,start_lost,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11a.2:c.-242_666del | |||||||
cDNA_position | 775-1682 | |||||||
CDS_position | ?-666 | |||||||
Protein_position | ?-222 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 1-3/5 | |||||||
Y59A8B.11a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11a.3:c.-26-216_666del | |||||||
cDNA_position | ?-776 | |||||||
CDS_position | ?-666 | |||||||
Protein_position | ?-222 | |||||||
Intron_number | 1-3/5 | |||||||
Exon_number | 2-4/6 | |||||||
Y59A8B.11b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11b.1:c.47-216_738del | |||||||
cDNA_position | ?-738 | |||||||
CDS_position | ?-738 | |||||||
Protein_position | ?-246 | |||||||
Intron_number | 1-2/3 | |||||||
Exon_number | 2-3/4 | |||||||
Y59A8B.11a.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.11a.4:c.-26-216_666del | |||||||
cDNA_position | ?-810 | |||||||
CDS_position | ?-666 | |||||||
Protein_position | ?-222 | |||||||
Intron_number | 1-3/5 | |||||||
Exon_number | 2-4/6 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Mapping_data | In_multi_point | 5668 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | |||||||
Remark | 153176/153177-154133/154134 (957 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |