WormBase Tree Display for Variation: WBVar00250991

WBVar00250991 Name: Public_name: tm2045
    Other_name: T19C3.4.1:c.165_449+7delinsC
    HGVSg: CHROMOSOME_III:g.619062_619606delinsG
  Sequence_details: SMap: S_parent: Sequence: T19C3
    Flanking_sequences: tgaaaagttgacgcttccggaattggtggg tccaggaggttttcaagaaatgagtaaatg
    Mapping_target: T19C3
    Source_location: 7 CHROMOSOME_III 619061 619607 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm2045_external
      tm2045_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2045
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00020562
    Transcript: T19C3.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: T19C3.4.1:c.165_449+7delinsC
        cDNA_position: 207-?
        CDS_position: 165-?
        Protein_position: 55-?
        Intron_number: 3-5/6
        Exon_number: 3-5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 13044/13045-G-13589/13590 (545 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele