WormBase Tree Display for Variation: WBVar00250886

WBVar00250886 Name: Public_name: tm1925
    Other_name: F54E7.7.1:c.494+235_515delinsTGTCGATT
    HGVSg: CHROMOSOME_III:g.5682747_5683203delinsAATCGACA
  Sequence_details: SMap: S_parent: Sequence: F54E7
    Flanking_sequences: ggatgaacaatgattgctggtgtcagctcg gagctcgtaaatcgacacaagtgctacagt
    Mapping_target: F54E7
    Source_location: 7 CHROMOSOME_III 5682746 5683205 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATCGACAC
      Deletion
    PCR_product: tm1925_external
      tm1925_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1925
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004321
    Transcript: F54E7.7.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F54E7.7.1:c.494+235_515delinsTGTCGATT
        cDNA_position: ?-584
        CDS_position: ?-515
        Protein_position: ?-172
        Intron_number: 4/5
        Exon_number: 5/6
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
    Mapping_data: In_multi_point: 5250
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Ahnn: normal locomotion. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: KJ
  Remark: 29063/29064-AATCGACAC-29521/29522 (458 bp deletion + 9 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele