WormBase Tree Display for Variation: WBVar00250682
expand all nodes | collapse all nodes | view schema
WBVar00250682 | Name | Public_name | tm1711 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F42G9.7.1:c.637-234_758-100del | |||||||
HGVSg | CHROMOSOME_III:g.787700_788561del | |||||||
Sequence_details | SMap | S_parent | Sequence | F42G9 | ||||
Flanking_sequences | attttcaagttaaaattctagttaactata | tgtttggatacaaattaaaagtctgtcaca | ||||||
Mapping_target | F42G9 | |||||||
Source_location | 7 | CHROMOSOME_III | 787699 | 788562 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1711_external | |||||||
tm1711_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1711 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004922 | ||||||
Transcript | F42G9.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F42G9.7.1:c.637-234_758-100del | |||||||
Intron_number | 5-6/9 | |||||||
Exon_number | 6/10 | |||||||
Interactor | WBInteraction000520044 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Mapping_data | In_multi_point | 5047 | ||||||
Description | Phenotype | WBPhenotype:0000204 | Paper_evidence | WBPaper00042242 | ||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant shows mild defects in aBoc steps. | Paper_evidence | WBPaper00042242 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00042242 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | The mutation caused a detectable defect in the expulsion of gut contents (Exp) reducing the Exp frequency. Measured as Exp per cycle (Exp frequency). | Paper_evidence | WBPaper00042242 | |||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000103 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000157 | Paper_evidence | WBPaper00042242 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00042242 | |||||||
Remark | 31884/31885-32746/32747 (862 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |