WormBase Tree Display for Variation: WBVar00250621

WBVar00250621 Name: Public_name: tm1642
    HGVSg: CHROMOSOME_III:g.5697189_5697618del
  Sequence_details: SMap: S_parent: Sequence: B0336
    Flanking_sequences: ctgctcgaccggctcaatatccttttcata acatcgggatagcgtctgaaaatttgattt
    Mapping_target: B0336
    Source_location: 7 CHROMOSOME_III 5697188 5697619 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1642_external
      tm1642_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1642
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002982
      WBGene00015147
    Transcript: B0336.7b.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-105
        Exon_number: 1/7
      B0336.8.1 VEP_consequence: coding_sequence_variant,3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 292-?
        CDS_position: 289-?
        Protein_position: 97-?
        Exon_number: 4-5/5
      B0336.7a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-129
        CDS_position: ?-111
        Protein_position: ?-37
        Intron_number: 2/7
        Exon_number: 1-3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0001302 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. H. Zhang: accumulation of several germline P granule components in somatic cells. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HZ
  Remark: 10165/10166-10595/10596 (430 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele