WormBase Tree Display for Variation: WBVar00250579

WBVar00250579 Name: Public_name: tm1597
    HGVSg: CHROMOSOME_II:g.8129571_8129974del
  Sequence_details: SMap: S_parent: Sequence: C41C4
    Flanking_sequences: ctgaattgcttgtattaatactgtcatact atgtattgcacgtagtacatgaacaataac
    Mapping_target: C41C4
    Source_location: 7 CHROMOSOME_II 8129570 8129975 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1597_external
      tm1597_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1597
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006739
    Transcript: C41C4.6.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: ?-15
        Exon_number: 1/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000050 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Ahringer to the National Bioresource Project of Japan: low percentage embryonic lethality (might be from side mutation). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        Penetrance: Low: Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
      WBPhenotype:0000697 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. J. Ahringer to the National Bioresource Project of Japan: low percentage pvl (might be from side mutation). Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
        Penetrance: Low: Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000275 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. W. Vermeulen: not sensitive to UV-irradiation. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: wt locomotion Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000680 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comments to the National Bioresource Project of Japan: Dr. J. Kaplan: wt aldicarb sensitivity. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
        Affected_by: Molecule: WBMol:00003650 Person_evidence: WBPerson7743
              Curator_confirmed: WBPerson712
  Remark: 30098/30099-30502/30503 (404 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele