WormBase Tree Display for Variation: WBVar00250577

WBVar00250577 Name: Public_name: tm1595
    Other_name: W06D4.5.1:c.174_*29delinsTG
    HGVSg: CHROMOSOME_I:g.9063705_9064137delinsCA
  Sequence_details: SMap: S_parent: Sequence: W06D4
    Flanking_sequences: taactctgggtattttgagatttttctcgt gggagattcgactgaaacaacgattttatt
    Mapping_target: W06D4
    Source_location: 7 CHROMOSOME_I 9063704 9064138 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: CA
      Deletion
    PCR_product: tm1595_external
      tm1595_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1595
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006503
    Transcript: W06D4.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: W06D4.5.1:c.174_*29delinsTG
        cDNA_position: 179-523
        CDS_position: 174-?
        Protein_position: 58-?
        Intron_number: 4/5
        Exon_number: 4-6/6
    Interactor: WBInteraction000505160
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype (14)
    Phenotype_not_observed: WBPhenotype:0000050 Paper_evidence: WBPaper00040324
        Curator_confirmed: WBPerson7575
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. G. Hermann to the National Bioresource Project of Japan: wild-type gut granules. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: GH
      WBPhenotype:0000120 Paper_evidence: WBPaper00040324
        Curator_confirmed: WBPerson7575
        Remark: No change in CED-1 levels in the gonadal sheath cells Paper_evidence: WBPaper00040324
            Curator_confirmed: WBPerson7575
      WBPhenotype:0000241 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. Z. Zhou: no persistent cell corpses. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: ZH
      WBPhenotype:0000623 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. S. Shaham: no obvious defects in glia development. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: OS
      WBPhenotype:0000637 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. M. Driscoll: normal dauer formation Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: ZB
      WBPhenotype:0000739 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan: Dr. M. Hengartner: no altered DNA damage responses. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: WS
      WBPhenotype:0000886 Person_evidence: WBPerson7575
        Curator_confirmed: WBPerson712
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment to the National Bioresource Project of Japan from Dr. H. Sawa: non-Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: HS
  Reference: WBPaper00040324
    WBPaper00053421
  Remark: 13634/13635-CA-14067/14068 (433 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele